outlier calculator (graphpad software 2014) Search Results


99
Malvern Panalytical 2012 graphpad prism version 7 00 graphpad
2012 Graphpad Prism Version 7 00 Graphpad, supplied by Malvern Panalytical, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2012 graphpad prism version 7 00 graphpad/product/Malvern Panalytical
Average 99 stars, based on 1 article reviews
2012 graphpad prism version 7 00 graphpad - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad quickcalcs software
Graphpad Quickcalcs Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad quickcalcs software/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad quickcalcs software - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prisma software package
Prisma Software Package, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prisma software package/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prisma software package - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc grubbs’ test
Grubbs’ Test, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grubbs’ test/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
grubbs’ test - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prism 6
Graphpad Prism 6, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prism 6/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prism 6 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prism 6 for windows
Prism 6 For Windows, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism 6 for windows/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prism 6 for windows - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc quickcalcs 2014 software
Quickcalcs 2014 Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/quickcalcs 2014 software/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
quickcalcs 2014 software - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc paired t-test 95% confidence interval
Paired T Test 95% Confidence Interval, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paired t-test 95% confidence interval/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
paired t-test 95% confidence interval - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prism 8
Prism 8, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism 8/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prism 8 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

96
Addgene inc paper na recombinant dna plenticrispr v2
Paper Na Recombinant Dna Plenticrispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper na recombinant dna plenticrispr v2/product/Addgene inc
Average 96 stars, based on 1 article reviews
paper na recombinant dna plenticrispr v2 - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

96
Addgene inc 2014 addgene plasmid
2014 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2014 addgene plasmid/product/Addgene inc
Average 96 stars, based on 1 article reviews
2014 addgene plasmid - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

99
Nikon 2014 control sirna software
Key Resources Table
2014 Control Sirna Software, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2014 control sirna software/product/Nikon
Average 99 stars, based on 1 article reviews
2014 control sirna software - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

Image Search Results


Key Resources Table

Journal: Immunity

Article Title: The Endotoxin Delivery Protein HMGB1 Mediates Caspase-11-Dependent Lethality in Sepsis

doi: 10.1016/j.immuni.2018.08.016

Figure Lengend Snippet: Key Resources Table

Article Snippet: Lab Described in current manuscript Experimental Models: Organisms/Strains C57BL/6 mice Jackson Laboratories 000664 Casp11 −/− mice University of Pittsburgh Animal Housing Described in current manuscript Nlrp3 −/− mice Genentech Inc Mariathasan et al., 2006 Asc −/− mice Genentech Inc Mariathasan et al., 2006 Gsdmd −/− mice University of Pittsburgh Animal Housing He et al., 2015 Ager −/− mice University of Pittsburgh Animal Housing Wendt et al., 2003 Tlr4 −/− mice University of Pittsburgh Animal Housing Deng et al., 2013 B6.129P2-Lyz2tm1(cre)Ifo/J Jackson Laboratories 004781 B6.Cg- Speer6-ps1Tg(Alb-cre)21Mgn/ J Jackson Laboratories 003574 Tlr4 fl/fl mice University of Pittsburgh Animal Housing Deng et al., 2013 Casp11 fl/fl mice University of Pittsburgh Animal Housing Described in current manuscript Hmgb1 fl/fl mice University of Pittsburgh Animal Housing Described in current manuscript Oligonucleotides 5′-ACT TTC TCT CTT CTC ACT −3′, 5′-TGT CTA ACT ATA TTG AAA TGT G-3′ Invitrogen Casp11 -specific primers TCTACACTATAGTCCAGACCC Shi et al., 2014 CASP4 -specific siRNA GTCTGGACTATAGTGTAGATG Shi et al., 2014 CASP4 -specific siRNA CGTACGCGGAATACTTCGA Shi et al., 2014 Control siRNA Software and Algorithms Graphpad Prism 5 software Graphpad Prism 5 software N/A Adobe Illustrator CC 2015 Adobe N/A NIS Elements software Nikon Instruments N/A Microsoft Excel Microsoft N/A Open in a separate window Contact for Reagent and Resource Sharing Further information and requests for reagents may be directed to and will be fulfilled by the Lead Contact, Ben Lu ( nc.ude.usc@ulnebyx ).

Techniques: In Vivo, Enzyme-linked Immunospot, Recombinant, Transfection, In Situ, Enzyme-linked Immunosorbent Assay, Selection, Control, Software