|
Malvern Panalytical
2012 graphpad prism version 7 00 graphpad 2012 Graphpad Prism Version 7 00 Graphpad, supplied by Malvern Panalytical, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2012 graphpad prism version 7 00 graphpad/product/Malvern Panalytical Average 99 stars, based on 1 article reviews
2012 graphpad prism version 7 00 graphpad - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
graphpad quickcalcs software Graphpad Quickcalcs Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad quickcalcs software/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad quickcalcs software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
prisma software package Prisma Software Package, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prisma software package/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prisma software package - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
grubbs’ test Grubbs’ Test, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/grubbs’ test/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
grubbs’ test - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
graphpad prism 6 Graphpad Prism 6, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad prism 6/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad prism 6 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
prism 6 for windows Prism 6 For Windows, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prism 6 for windows/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prism 6 for windows - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
quickcalcs 2014 software Quickcalcs 2014 Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quickcalcs 2014 software/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
quickcalcs 2014 software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
paired t-test 95% confidence interval Paired T Test 95% Confidence Interval, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paired t-test 95% confidence interval/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
paired t-test 95% confidence interval - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
prism 8 Prism 8, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prism 8/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prism 8 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Addgene inc
paper na recombinant dna plenticrispr v2 Paper Na Recombinant Dna Plenticrispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paper na recombinant dna plenticrispr v2/product/Addgene inc Average 96 stars, based on 1 article reviews
paper na recombinant dna plenticrispr v2 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Addgene inc
2014 addgene plasmid 2014 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2014 addgene plasmid/product/Addgene inc Average 96 stars, based on 1 article reviews
2014 addgene plasmid - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Nikon
2014 control sirna software ![]() 2014 Control Sirna Software, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2014 control sirna software/product/Nikon Average 99 stars, based on 1 article reviews
2014 control sirna software - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Immunity
Article Title: The Endotoxin Delivery Protein HMGB1 Mediates Caspase-11-Dependent Lethality in Sepsis
doi: 10.1016/j.immuni.2018.08.016
Figure Lengend Snippet: Key Resources Table
Article Snippet: Lab Described in current manuscript Experimental Models: Organisms/Strains C57BL/6 mice Jackson Laboratories 000664 Casp11 −/− mice University of Pittsburgh Animal Housing Described in current manuscript Nlrp3 −/− mice Genentech Inc Mariathasan et al., 2006 Asc −/− mice Genentech Inc Mariathasan et al., 2006 Gsdmd −/− mice University of Pittsburgh Animal Housing He et al., 2015 Ager −/− mice University of Pittsburgh Animal Housing Wendt et al., 2003 Tlr4 −/− mice University of Pittsburgh Animal Housing Deng et al., 2013 B6.129P2-Lyz2tm1(cre)Ifo/J Jackson Laboratories 004781 B6.Cg- Speer6-ps1Tg(Alb-cre)21Mgn/ J Jackson Laboratories 003574 Tlr4 fl/fl mice University of Pittsburgh Animal Housing Deng et al., 2013 Casp11 fl/fl mice University of Pittsburgh Animal Housing Described in current manuscript Hmgb1 fl/fl mice University of Pittsburgh Animal Housing Described in current manuscript Oligonucleotides 5′-ACT TTC TCT CTT CTC ACT −3′, 5′-TGT CTA ACT ATA TTG AAA TGT G-3′ Invitrogen Casp11 -specific primers TCTACACTATAGTCCAGACCC Shi et al., 2014 CASP4 -specific siRNA GTCTGGACTATAGTGTAGATG Shi et al., 2014 CASP4 -specific siRNA CGTACGCGGAATACTTCGA Shi et al.,
Techniques: In Vivo, Enzyme-linked Immunospot, Recombinant, Transfection, In Situ, Enzyme-linked Immunosorbent Assay, Selection, Control, Software